This is an example of DNA sequences in FASTA format.

> seq_1 comment for the first sequence. This line can be anything.
ACCCTCTTGTATAGCAGCAGATGACCGGGTGTTGCCACTCATAGCCTTCCGATGGAGAG
AAGCGCGGGCCACTAGAAGATAATGTCGGGCCCTTGAGCGCGCC
> seq_2 comment for the second sequence. This line can be anything.
TTGACTGGACTGCTCAAATCGATCAGGAATTTGGCCGGCTAAAAACCCTGGACGACAAACCGTTGC
CCAGGAGACGGTCTGACCCGTCTAATGAGCGACTATAAGGTCGTCGCCACGGTATGTCCCAAGGGTAAAACCAACTGAC
CACTGGCCAATGAGAAAGTAGATTGGCCACGTACTCGCCTCTCTCTCGTCAGGAACAACATAAGCCCGACCGG
> seq_3 comment for the third sequence. This line can be anything.
ACCCTCTTGTATAGCAGCAGATGACCGGGTGTTGCCACTCATAGCCTTCCGATGGAGAG
AAGCGCGGGCCACTAGAAGATAATGTCGGGCCCTTGAGCGCGCC
> seq_4 comment for the 4th sequence. This line can be anything.
AATCTTCGTACGCCGAGGCCAGTACGCGCATTGGCAGTATGCAAATACGCT
> seq_5 comment for the 5th sequence. This line can be anything.
GTCGTCGAACAGTAGGTCAATTTCTTCACTCCTATCGCTTGGAA
> seq_6 comment for the 6th sequence. This line can be anything.
ATCTACTTACGCGGCTGCTGGCTTTAAGGTTCTCTTGATGTTGGATTGTGGAGATACGCCTCGT